1403787-62-1

1403787-62-1 structure

Name: Bepirovirsen
Chemical Name: Bepirovirsen
CAS Number: 1403787-62-1
Molecular Formula:
Molecular Weight:
Catalog: Signaling Pathways Anti-infection HBV
Create Date: 2022-08-16 23:04:04
Modify Date: 2024-01-03 17:45:22
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].

Name	Bepirovirsen

Description	Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
Related Catalog	Research Areas >> Infection Signaling Pathways >> Anti-infection >> HBV
References	[1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.

No Any Chemical & Physical Properties