HBV-IN-29 (ex8), a flavone derivative, is a potent covalently closed circular DNA (cccDNA) inhibitor. cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-29 has the potential for the research of HBV infection[1].
HBV-IN-32 is a potent cccDNA (covalently closed circular DNA) inhibitor. HBV-IN-32 shows anti-HBV activity with an IC50 value of 0.14 µM for HBsAg. HBV-IN-32 inhibits cell growth[1].
Oleana-2,12-dien-28-oic acid is an HBV-DNA inhibitor, HBsAg and HBeAg inhibitor. Oleana-2,12-dien-28-oic acid can be used in hepatitis B virus infection disease research[1].
HBV-IN-7 is a potent HBV inhibitor with an EC50 of 7 nM (WO2021213445A1, compound 5)[1].
Emtricitabine triphosphate tetrasodium salt is the tetrasodium salt form of Emtricitabine triphosphate (HY-131596). However，Emtricitabine triphosphate ((-)-Emtricitabine triphosphate) is the phosphorylated anabolite of Emtricitabine (HY-17427)，a nucleoside reverse transcriptase inhibitor，targeting to HIV and HBV[1].
Tuvirumab (OST 577; SDZ-OST 577) is a human IgG1 subclass monoclonal antibody directed against HBV surface antigen (HBsAg). Tuvirumab binds specifically and with high affinity (K=3.6 nM) to HBsAg. Tuvirumab has the potential for chronic hepatitis B research[1][2].
Adefovir Dipivoxil works by blocking reverse transcriptase, an enzyme that is crucial for the hepatitis B virus (HBV) to reproduce in the body.Target: NRTIs; HBVAdefovir Dipivoxil works by blocking reverse transcriptase, an enzyme that is crucial for the hepatitis B virus (HBV) to reproduce in the body. Adefovir Dipivoxil is used for treatment of hepatitis B and herpes simplex virus infection [1-3]. Adefovir Dipivoxil is approved for the treatment of chronic hepatitis B in adults with evidence of active viral replication and either evidence of persistent elevations in serum aminotransferases (primarily ALT) or histologically active disease. Adefovir Dipivoxil is a failed treatment for HIV[3, 4].
Tenofovir dsoproxil is a nucleotide reverse transcriptase inhibitor to treat HIV and chronic Hepatitis B.
BAY 41-4109 racemate is the racemate of BAY 41-4109. BAY 41-4109 is a potent inhibitor of human hepatitis B virus (HBV) with an IC50 of 53 nM.
Selgantolimod (GS-9688; GS9688) is a novel toll-like receptor TLR8 modulator for the treatment of HIV infection.
AB-423 is an inhibitor of HBV capsid assembly, and potent inhibits HBV replication with EC50/EC90 of 0.08-0.27 μM/0.33-1.32 μM in cells.
HBV-IN-25 is a good potency, orally active novel HBV cccDNA reducer. HBV-IN-25 has anti-HBeAg potency and anti-HBV activity with IC50 values of 0.58 μM and 1.15 μM, respectively. HBV-IN-25 has good aqueous solubility (LYSA＞452 μg/mL) and good PK property with no cellular toxicity[1].
HBV-IN-21 (Compound II-8b) is an HBV DNA replication inhibitor with an IC50 of 2.2 µM. HBV-IN-21 can interact HBV 4 capsid protein with good affinity (KD = 60.0 μM)[1].
Azvudine is a potent nucleoside reverse transcriptase inhibitor (NRTI), with antiviral activity on HIV, HBV and HCV. Azvudine exerts highly potent inhibition on HIV-1 (EC50s ranging from 0.03 to 6.92 nM) and HIV-2 (EC50s ranging from 0.018 to 0.025 nM). Azvudine inhibits NRTI-resistant viral strains[1].
Coclauril is an inhibitor of HBV. Coclauril inhibits HBV replication in the human hepatoblastoma cell line with an EC50 of 7.6 μg/mL[1].
HBV-IN-14 is a potent inhibitor of covalently closed circular DNA (cccDNA). cccDNA serves as the template for viral RNA transcription and subsequent viral DNA generation. HBV-IN-14 is a pyridinopyrimidinones compound. HBV-IN-14 has the potential for the research of HBV infection (extracted from patent WO2021190502A1, compound 5)[1].
HBV-IN-6 is a potent HBV inhibitor with an EC50 of 44 nM (WO2021213445A1, compound 3)[1].
Inarigivir (ORI-9020;SB-9000) is a dinucleotide which can significantly reduce liver HBV DNA in transgenic mice expressing hepatitis B virus.
Clevudine is an antiviral drug for the treatment of hepatitis B. Target: HBVClevudine is a nucleoside analog with an unnatural beta-L configuration. Clevudine showed potent antiviral activity during therapy and induced a sustained posttreatment antiviral effect for 6 months after a 12-week treatment period, and this was associated with a sustained normalization of ALT levels [1]. Clevudine showed a potent antiviral response, and its effect was higher in HBeAg-negative patients, with rapid viral load reduction after therapy. However, long-term therapy for more than 1 year resulted in the development of considerable resistance and myopathy. Therefore, we should consider alternative antiviral agents if clevudine resistance or clevudine-induced myopathy is developed in patients on clevudine for the treatment of CHB [2].
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1].
NVR 3-778 is a first-in-Class and oral bioavailable HBV CAM (capsid assembly modulator) belonging to the SBA (sulfamoylbenzamide) class, with anti-HBV activity[1].
Merimepodib is a novel noncompetitive inhibitor of IMPDH (Inosine monophosphate dehydrogenase).
Neracorvir is a potent antiviral agent. Neracorvir exhibits anti-HBV activity[1][2].
Vidarabine phosphate (Ara-AMP), an antiviral agent, inhibits chronic HBV infection[1][2]. Vidarabine phosphate also against herpes simplex and varicella zoster viruses[3].
Helioxanthin 8-1 is an analogue of helioxanthin, exhibites significant in vitro anti-HBV/HCV/HSV-1/HIV activity with EC50 of >5/10/1.4/15 uM.IC50 value: >5/10/1.4/15 uM(HBV/HCV/HSV-1/HIV) [1]Target: Antiviral agentThe cyclic hydrazide 28(Helioxanthin 8-1) showed the most potent antiHBV activity among those helioxanthin analogues tested. In addition, compound 28 exhibited moderately potent activity against HIV. It would therefore be promising to study helioxanthin analogues that contain a six-membered ring instead of the five-membered ring found in the lactam [1]. 8-1 exhibited effective inhibition on DHBV replication. The combination of 8-1 with 3TC resulted in additional anti-DHBV activity. Viral induced cells displayed higher susceptibility to 8-1 treatment than non-induced cells. HBV X protein might not be an essential factor in the initiation of the biological activity of 8-1, as demonstrated by its absence in DHBV [2].
3'-DMTr-dG(iBu) is a nucleoside for the synthesis of nucleic acid, such as antiviral agents used in the research of viral infection (HBV, HDV), and oligonucleotides against Alzheimer’s disease and other tauopathies[1].
Swertianolin, a xanthone isolated from Gentianella Acuta, inhibits acetylcholinesterase (AChE). Swertianolin also exhibits anti-HBV and anti-bacterial activity[1][2].
Schisanwilsonin C (Arisanschinin K) shows anti-HBV activity[1].
Chamaechromone is a biflavonoid ingredient isolated from the roots of Stellera chamaejasme L. (Thymelaeaceae). Chamaechromone possesses anti-hepatitis B virus (HBV) effects against the surface antigen of HBV (HBsAg) secretion and has insecticidal activities[1].
Brain Derived Basic Fibroblast Growth Factor (1-24) (FGF basic 1-24) is a synthetic peptide, shows anti-bacterial and anti-HBV activities. Brain Derived Basic Fibroblast Growth Factor (1-24) can be used in infection disease and immune disease research[1].